DNA Structure
Quiz by Grace Gooch Newsom
Feel free to use or edit a copy
includes Teacher and Student dashboards
Measure skillsfrom any curriculum
Measure skills
from any curriculum
Tag the questions with any skills you have. Your dashboard will track each student's mastery of each skill.
With a free account, teachers can
- edit the questions
- save a copy for later
- start a class game
- automatically assign follow-up activities based on students’ scores
- assign as homework
- share a link with colleagues
- print as a bubble sheet
11 questions
Show answers
- Q1Which component makes up the sides of the DNA ladder?Hydrogen bondsSugar and phosphateWater moleculesNitrogen bases30s
- Q2What is the shape of a DNA molecule?Single strandDouble helixTriple helixSquare30s
- Q3Which nitrogen base pairs with adenine in a DNA molecule?CytosineUracilThymineGuanine30s
- Q4What is the full form of DNA in biology?Dinitroaniline acidDeoxyribonucleic acidDihydroxybutanoic acidDiaminonaphthalene alkane30s
- Q5Which scientist is credited with the discovery of the structure of DNA?Rosalind FranklinAlfred HersheyGregor MendelJames Watson and Francis Crick30s
- Q6What are the building blocks of a DNA molecule?Amino acidsLipidsMonosaccharidesNucleotides30s
- Q7What is the primary function of DNA in living organisms?To regulate cellular processesTo produce proteinsTo provide energyTo store genetic information30s
- Q8What is the complementary DNA sequence to the following DNA strand: TACGCA?ACTGATATGCGTTGCACGTAGCCA30s
- Q9What is the sugar component in a DNA molecule?DeoxyriboseFructoseRiboseGlucose30s
- Q10Which nucleotide is always paired with guanine in a DNA molecule?AdenineUracilCytosineThymine30s
- Q11What holds the nitrogenous bases together in a DNA molecule?Hydrogen bondsCovalent bondsIonic bondsVan der Waals forces30s