![placeholder image to represent content](/_next/image?url=%2Fassets%2Fquiz_default_logo.jpg&w=256&q=75)
DNA Structure and Replication Pre-Quiz
Quiz by Christine Dougherty
Feel free to use or edit a copy
includes Teacher and Student dashboards
Measure skillsfrom any curriculum
Measure skills
from any curriculum
Tag the questions with any skills you have. Your dashboard will track each student's mastery of each skill.
With a free account, teachers can
- edit the questions
- save a copy for later
- start a class game
- automatically assign follow-up activities based on students’ scores
- assign as homework
- share a link with colleagues
- print as a bubble sheet
5 questions
Show answers
- Q11. DNA replication is semiconservative. Below is one template strand during DNA replication. Write the complementary strand that would result after replication. A T G C C A T G T A AATGCCATGTAATACGGTACATTTAGGGATCTAATACCGGTATAA45s
- Q2A molecule of DNA contains 10% adenine. How much cytosine does it contain?10%30%40%20%45s
- Q3Why is DNA replication “semi-conservative”?The new strands of DNA are made of new DNA onlyThe new DNA strands are made of old DNA onlyBoth strands of the replicated molecule are differentEach strand of the replicated molecule is made of one old strand and one new strand45s
- Q4Which is the monomer of nucleic acids?phosphatenucleotidedeoxyribosenucleic acid45s
- Q5Which is the function of DNA polymerase?adds new nucleotides to the growing strand based in complementary base pair rulesunwinds the DNA double helixseals new nucletoides togetherkeeps the unwound strand separated45s