
FORMATIVE ASSESSMENT TEST – Grade 9 (SCIENCE)
Quiz by Maricar Y. Ladines
Grade 9
Science
Philippines Curriculum: Grades K-10 (MELC)
Feel free to use or edit a copy
includes Teacher and Student dashboards
Measures 3 skills from
Measures 3 skills from
Track each student's skills and progress in your Mastery dashboards
With a free account, teachers can
- edit the questions
- save a copy for later
- start a class game
- automatically assign follow-up activities based on students’ scores
- assign as homework
- share a link with colleagues
- print as a bubble sheet
20 questions
Show answers
- Q1Choose the correct answer. It is the life support structure that nourishes the cells with nutrients from the food you eat and oxygen from the air you breathe.Excretory SystemRespiratory SystemDigestive SystemCirculatory System30sS9LT-la-b-26
- Q2Choose the correct answer. What carries the materials throughout the body?HeartBlood VesselsVeinsBlood30sS9LT-la-b-26
- Q3Choose the correct answer. What do you call the structure in the heart and some veins that prevents the blood from flowing backward?ValveAtriumAortaVentricle30sS9LT-la-b-26
- Q4Choose the correct answer. Among the following choices below, select the one that shows the correct order of blood flow.Right atrium – Left atrium – Right ventricle – Left VentricleRight atrium – Right ventricle – Left atrium – Left ventricleLeft Ventricle - Left atrium - Right ventricle - Right atriumLeft atrium - Left ventricle – Right atrium – Right ventricle30sS9LT-la-b-26
- Q5Choose the correct answer. How would you best correlate a public utility vehicle with the functions of your blood?It travels around to pick up and transport passengersAll of the aboveIt travels around to pick up passengersIt travels around to transport passengers30sS9LT-la-b-26
- Q6Choose the correct answer. What will occur when the blood flow to a tissue of the heart is blocked by a blood clot?HypertensionAngina pectorisArteriosclerosisThrombosis30sS9LT -lc -27
- Q7Choose the correct answer. Which is the best way to prevent diseases of the respiratory and circulatory system?Balanced dietStressful environmentLack of sleepVices30sS9LT -lc -27
- Q8Choose the correct answer. What is the main idea behind cigarette smoking?It damages the normal function of the lungsIt is actually alright if you take it in moderationIt should be stopped at the age of 30It should be taken occasionally30sS9LT -lc -27
- Q9Choose the correct answer. What alternative would you suggest to avoid circulatory diseases?Schedule a regular exerciseVisit a doctor only when not feeling wellStay late at night all the timeInclude fatty foods in your diet30sS9LT -lc -27
- Q10Choose the correct answer. What should you propose if someone you know sustained an open wound and whose blood do not clot naturally?She should have a dose of plasma immediatelyNothing because clotting is not importantShe must initially apply pressure over the woundShe should visit a doctor right away30sS9LT -lc -27
- Q11Choose the correct answer. It is a threadlike structure of nucleic acids and protein found in the nucleus of most living cells, carrying genetic information in the form of genes.CellDNAGenesChromosomes30sS9LT -Id -29
- Q12Choose the correct answer. The genetic information of an organism is stored in DNA molecules. How many paired DNA molecules are in a human body?2223454630sS9LT -Id -29
- Q13Choose the correct answer. What word is used to describe the exact position of a gene on a chromosome?CenterLocusFocusAxis30sS9LT -Id -29
- Q14Choose the correct answer. What could be the outcome if something wrong happens with the chromosome of a child?She will live normally just like any other childA serious health condition is possibleThey will still look just fineNothing strange will happen30sS9LT -Id -29
- Q15Choose the correct answer. In DNA, adenine pairs only with thymine and cytosine pairs only with guanine. If the left chain of a DNA molecule has the nucleotide sequence CCGTAGGCC, what is the sequence of the right chain of the DNA molecule?GCGAAGCGCGGCATCCGGGGGTTCCGGGGCATCCCC30sS9LT -Id -29