
Genetics
Quiz by Mrs. Covington
Feel free to use or edit a copy
includes Teacher and Student dashboards
Measure skillsfrom any curriculum
Measure skills
from any curriculum
Tag the questions with any skills you have. Your dashboard will track each student's mastery of each skill.
With a free account, teachers can
- edit the questions
- save a copy for later
- start a class game
- automatically assign follow-up activities based on students’ scores
- assign as homework
- share a link with colleagues
- print as a bubble sheet
15 questions
Show answers
- Q1Which one is NOT a genetic trait that we discussed in class?Earlobe AttachmentHairlinePTCSocioeconomic Status30s
- Q2About what % of the US population is left handed?10%25%40%5%30s
- Q3Which genetic trait is controlled by the MC1R Gene?PTC TastingFrecklesAllergiesHitchhiker's Thumb30s
- Q4Who is usually the carrier for Red/Green colorblindness?MotherGrandfatherGrandmotherFather30s
- Q5Red/Green colorblindness is controlled by one gene on which chromosome?XYXYZ30s
- Q6Who is colorblindness most common in?FemalesChildrenMalesAdults30s
- Q7In order for a girl to be colorblind, what must happen?0 defective X chromosomes2 defective Y chromosomes2 defective X chromosomes1 defective Y chromosome30s
- Q8If you have an allergy, what is the percent chance that you will pass this onto your child?10%25%100%50%30s
- Q9PTC is a chemical found on the tongue that controls the ____________ taste.BitterSweetSourSalty30s
- Q10PTC is found in which foods?Processed MeatsTomato productsBroccoli, cauliflower, etcFast food30s
- Q11How many pairs of chromosomes does a human have?2423462130s
- Q12Adenine pairs with _______________.CystineAdenineThymineGuanine30s
- Q13The sequence (order) of your DNA bases determines your _______________SchoolNameEducationTraits30s
- Q14Guanine pairs with ______________________________AdenineGuanineThymineCystine30s
- Q15Correct match the DNA sequence: AATCCGATTACCGATTTGGCAAATCCGATTAGGCT30s