
Genetics/DNA
Quiz by Robin Rathman
Feel free to use or edit a copy
includes Teacher and Student dashboards
Measure skillsfrom any curriculum
Measure skills
from any curriculum
Tag the questions with any skills you have. Your dashboard will track each student's mastery of each skill.
With a free account, teachers can
- edit the questions
- save a copy for later
- start a class game
- automatically assign follow-up activities based on students’ scores
- assign as homework
- share a link with colleagues
- print as a bubble sheet
35 questions
Show answers
- Q1The discovery of which of the following has most directly led to advances in the identification of suspects in criminal investigations and in the identification of genetic diseases?Sterile ProceduresAntibioticsDNA StructureCell Structure30s
- Q2Which sequence of DNA bases would pair with the ones in the partial strand of ATGTGACAG ?CATTCACTGATGTGACAGTACACTGTCGTAAGTGAC30s
- Q3What molecules do both DNA and RNA contain?ThymineNucleotidesUracilDeoxyribose30s
- Q4The genetic material of an organism is composed ofcomplex carbohydrateslipidsproteinsDeoxyribonucleic acids30s
- Q5Which of the following best describes how DNA and RNA are similarThey both are formed in a double helix structureThey both contain the nitrogen bases thymine and adenineThey both are composed of five different nucleotidesThey both contain the nitrogen bases cytosine and guanine30s
- Q6Which of the following base pair sequences could be produced in DNA replication?5’ AGTCAT 3’ pairs with 3’ UCAGUA 5’5’ AGTCAT 3’ pairs with 3’ CTGACG 5’5’ AGTCUT 3’ pairs with 3’ TCUGTA 5’5’ AGTCAT 3’ pairs with 3’ TCAGTA 5’30s
- Q7Semi-conservative replication of DNA refers to the idea thatEach half of the original DNA molecule is joined with a new complementary DNA strand.Each new DNA molecule contains two new single RNA strands.DNA molecules need to unwind before duplication begins.The two strands of DNA molecules run in opposite directions.30s
- Q8A chromosome is best described as aA green cell found in many plants.A gene that has more than one form.A reproductive cell found in certain kinds of bacteria.A strand of DNA containing genetic information.30s
- Q9Which statement about DNA is correct ?A child’s DNA will be unrelated to the mother’s or father’s DNA.A female child’s DNA will exactly match the mother’s DNA.A male child’s DNA will exactly match the father’s DNA.A child’s DNA will show similarities to both the mother’s and father’s DNA.30s
- Q10DNA contains the code for constructing which molecules ?FatsStarchesProteinsSugars30s
- Q11In humans, B is the allele for brown eyes and b is the allele for blue eyes. Two brothers both have brown eyes, but one of them has both the B and b alleles while the other only has B alleles. Which statement is true about the brothers?They have the same genotype but different phenotypesThey have the same phenotype but different genotypesThey have the same genotype and phenotypeThey have different phenotypes and genotypes30s
- Q12Which of the following best describes the number of chromosomes in a normal human liver cell?23 pairs of chromosomes23 original and 23 duplicate chromosomes46 different types of chromosomes46 male and 46 female chromosomes30s
- Q13The instructions that determine coat color in dogs are stored in theCytoplasm of skin cellsMembrane of every cellChromosomes of every cellMitochondria of hair cells30s
- Q14Which of the following statements best describes a DNA molecule ?It is composed of amino acidsIt contains the sugar riboseIt contains the nitrogenous base uracilIt is a double helix30s
- Q15Which of the following are monomers that join together to form DNA, a polymerAmino acidsNucleotidesFatty acidsPolysaccharides30s