
Mitosis & Meiosis Test Review
Quiz by Rachel Sawyer
Feel free to use or edit a copy
includes Teacher and Student dashboards
Measure skillsfrom any curriculum
Measure skills
from any curriculum
Tag the questions with any skills you have. Your dashboard will track each student's mastery of each skill.
With a free account, teachers can
- edit the questions
- save a copy for later
- start a class game
- automatically assign follow-up activities based on students’ scores
- assign as homework
- share a link with colleagues
- print as a bubble sheet
12 questions
Show answers
- Q1What type of bonds are present in DNA?oxygenheliumnitrogenhydrogen30s
- Q2Which of the following is TRUE?The 4 nitrogen bases you have are dependent on what species you are.Humans are the only organisms that have ATCGNone of the answers are true.All organisms have the same 4 nitrogen bases (ATCG)45s
- Q3How can you identify if a person is female based on their karyotype?There is one X and one Y present.There are two X presentYou count their chromosomesYou cannot determine gender based on a karyotype.45s
- Q4____________ results in 4 cells that ____________ identical to the parent cell.MEIOSIS, AREMEIOSIS, ARE NOTMITOSIS, ARE NOTMITOSIS, ARE45s
- Q5Which process involves 1 cell division?heliocentrismmitosisbinary fissionmeiosis45s
- Q6Which phase is shown?telophasecytokinesismetaphaseanaphase45s
- Q7Which is an example of a somatic cell?sperm cellegg celllung cellbacteria45s
- Q8When is DNA copied?G1MitosisS phaseG245s
- Q9What is the DNA strand that is complementary to the following? ATGCGTTATACGCAATATACGTTCATGCGTTACGATAGGC45s
- Q10What process in meiosis allows for variation in genetics of the daughter cells?gamete formationnon disjunctiontrisomy 21crossing over45s
- Q11If the parent cell has 90 chromosomes, how many will the daughter cells have in MITOSIS?45901803045s
- Q12If an organism has a haploid number of 4, what is it's diploid number?148245s