
Review
Quiz by Beth DeParlier
Feel free to use or edit a copy
includes Teacher and Student dashboards
Measure skillsfrom any curriculum
Measure skills
from any curriculum
Tag the questions with any skills you have. Your dashboard will track each student's mastery of each skill.
With a free account, teachers can
- edit the questions
- save a copy for later
- start a class game
- automatically assign follow-up activities based on students’ scores
- assign as homework
- share a link with colleagues
- print as a bubble sheet
8 questions
Show answers
- Q1What is the purpose of DNA?to store and transmit the information needed to make proteinsto produce proteinsto transport cell productsto make energy30s
- Q2List the 3 structural forms of RNA.mRNA, tRNA, rRNA30s
- Q3What is another name for the process of protein synthesis?transcriptionreplicationtranspirationtranslation30s
- Q4Where does the strand of RNA go when it leaves the nucleus?to a ribosome in the cytoplasmawayto townto the ball30s
- Q5What would the complementary strand of DNA be from this original strand: GACGAACTTATACTGCTTGAATAT30s
- Q6What would the strand of mRNA look like that would come from this strand of DNA: ACGTTAGCGAGTCCGATTUGCAAUCGCUCAGGCUAA30s
- Q7What are the two attachments that are found on a transfer RNA molecule?an anticodon, and an amino acid30s
- Q8What is the universal start codon?UGAAUGAAGUCA30s