placeholder image to represent content

Genetics Unit Review/Test Take 2

Quiz by Mrs. Julie Stanfill

Our brand new solo games combine with your quiz, on the same screen

Correct quiz answers unlock more play!

New Quizalize solo game modes
29 questions
Show answers
  • Q1

    DNA replication is the process of ___.

    Making a protein with the DNA code

    mRNA copying the DNA code to make a protein

    tRNA copying the DNA for storage

    Copying the DNA...making an exact copy

    120s
  • Q2

    DNA replication is done for what purpose

    so your body can perform all of the required functions of reproduction

    to correct genetic problems

    for protein synthesis

    when cells are being made, so each new cell has the same DNA as the parent

    120s
  • Q3

    DNA is always located in the 

    cytoplasm

    ribosome

    golgi body

    nucleus

    120s
  • Q4

    Proteins are made on what organelle?

    Users re-arrange answers into correct order
    Jumble
    300s
  • Q5

    Choose the correct definition for the following terms

    Users link answers
    Linking
    300s
  • Q6

    The subunit of nucleic acids

    Users re-arrange answers into correct order
    Jumble
    300s
  • Q7

    Place in order the steps of protein synthesis

    Users link answers
    Linking
    300s
  • Q8

    Which nitrogen base is NOT found in RNA

    uracil

    thymine

    guanine

    adenine

    120s
  • Q9

    Group the items that go together

    Users sort answers between categories
    Sorting
    300s
  • Q10

    Nitrogen bases are held together by ___ bonds and the phosphate and sugar are held together by ___ bonds.

    covalent; hydrogen

    hydrogen; covalent

    ionic; covalent

    strong; weak

    120s
  • Q11

    Covalent bonds are 

    weak

    found only in water molecules

    nonexistent

    strong

    120s
  • Q12

    DNA can never come out of the nucleus.

    true
    false
    True or False
    60s
  • Q13

    DNA replication is considered semi-conservative which means that 1/2 of the strand is old and 1/2 is new made by base pairing

    true
    false
    True or False
    60s
  • Q14

    The DNA strand is replicated.  What is the new strand look like?  

    ATCGAGATCCCTATCGAATAG

    Users enter free text
    Type an Answer
    300s
  • Q15

    The mRNA strand looks like this...AUCACAUGCUUACGCAUGACUUUA.  How many amino acids could be coded with this strand?

    5

    8

    2

    24

    300s

Teachers give this quiz to your class