
Genetics Unit Review/Test Take 2
Quiz by Mrs. Julie Stanfill
Feel free to use or edit a copy
includes Teacher and Student dashboards
Measure skillsfrom any curriculum
Tag the questions with any skills you have. Your dashboard will track each student's mastery of each skill.
- edit the questions
- save a copy for later
- start a class game
- automatically assign follow-up activities based on students’ scores
- assign as homework
- share a link with colleagues
- print as a bubble sheet
- Q1
DNA replication is the process of ___.
Making a protein with the DNA code
mRNA copying the DNA code to make a protein
tRNA copying the DNA for storage
Copying the DNA...making an exact copy
120s - Q2
DNA replication is done for what purpose
so your body can perform all of the required functions of reproduction
to correct genetic problems
for protein synthesis
when cells are being made, so each new cell has the same DNA as the parent
120s - Q3
DNA is always located in the
cytoplasm
ribosome
golgi body
nucleus
120s - Q4
Proteins are made on what organelle?
Users re-arrange answers into correct orderJumble300s - Q5
Choose the correct definition for the following terms
Users link answersLinking300s - Q6
The subunit of nucleic acids
Users re-arrange answers into correct orderJumble300s - Q7
Place in order the steps of protein synthesis
Users link answersLinking300s - Q8
Which nitrogen base is NOT found in RNA
uracil
thymine
guanine
adenine
120s - Q9
Group the items that go together
Users sort answers between categoriesSorting300s - Q10
Nitrogen bases are held together by ___ bonds and the phosphate and sugar are held together by ___ bonds.
covalent; hydrogen
hydrogen; covalent
ionic; covalent
strong; weak
120s - Q11
Covalent bonds are
weak
found only in water molecules
nonexistent
strong
120s - Q12
DNA can never come out of the nucleus.
truefalseTrue or False60s - Q13
DNA replication is considered semi-conservative which means that 1/2 of the strand is old and 1/2 is new made by base pairing
truefalseTrue or False60s - Q14
The DNA strand is replicated. What is the new strand look like?
ATCGAGATCCCTATCGAATAG
Users enter free textType an Answer300s - Q15
The mRNA strand looks like this...AUCACAUGCUUACGCAUGACUUUA. How many amino acids could be coded with this strand?
5
8
2
24
300s